User guide¶
Basic usage¶
If you just want to trim a 3’ adapter, the basic command-line for atropos is:
atropos -a AACCGGTT -o output.fastq -se input.fastq
The sequence of the adapter is given with the -a option. Of course, you
need to replace AACCGGTT with your actual adapter sequence. Reads are read
from the input file input.fastq and written to the output file
output.fastq.
Atropos searches for the adapter in all reads and removes it when it finds it. All reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with command-line options, explained further down.
A report is printed after atropos has finished processing the reads.
Input and output file formats¶
Input files for atropos need to be in one the these formats:
- FASTA (file name extensions:
.fasta,.fa,.fna,.csfasta,.csfa) - FASTQ (extensions:
.fastq,.fq) - A pair of a FASTA file and a
.(cs)qualfile - SAM/BAM (extensions:
.sam,.bam)
The latter format is (or was) used for colorspace data from the SOLiD instruments.
The input file format is recognized from the file name extension (given in
parentheses in the list above). You can also explicitly specify which format
the input has by using the --format option.
Paired-end FASTQ files are supported using -pe1 and -pe2 to specify the
read 1 and read 2 files, respectively. Interleaved files (FASTQ, SAM, and BAM)
are supported using the -l option. Note that interleaved files must be
sorted such that both reads appear successively for each read pair. For SAM/BAM,
the two reads can be in any order since their identity is detected from the
flags. You must have the pysam library installed for SAM/BAM support. If you
only want to process one of the read pairs from an interleaved file, you can set
--single-input-read <1|2>.
The output file format is determined by the input format. By default, paired-end
output will be written into two files, one for each read. Set the -L option
to write inteleaved output instead. Also, atropos does not check the output file
name: If you input FASTQ data, but use -o output.fasta, then the output file
will actually be in FASTQ format.
Compressed files¶
Atropos supports compressed input and output files. Whether an input file
needs to be decompressed or an output file needs to be compressed is detected
automatically by inspecting the file name: If it ends in .gz, then gzip
compression is assumed. You can therefore run atropos like this and it works
as expected:
atropos -a AACCGGTT -o output.fastq.gz -se input.fastq.gz
All of atropos’s options that expect a file name support this.
Files compressed with bzip2 (.bz2) or xz (.xz) are also supported.
Standard input and output¶
If no output file is specified via the -o option, then the output is sent to
the standard output stream. Instead of the example command line from above, you
can therefore also write:
atropos -a AACCGGTT -se input.fastq > output.fastq
There is one difference in behavior if you use atropos without -o: The
report is sent to the standard error stream instead of standard output. You
can redirect it to a file like this:
atropos -a AACCGGTT -se input.fastq > output.fastq 2> report.txt
Wherever Atropos expects a file name, you can also write a dash (-) in
order to specify that standard input or output should be used. For example:
tail -n 4 input.fastq | atropos -a AACCGGTT -se - > output.fastq
The tail -n 4 prints out only the last four lines of input.fastq, which
are then piped into Atropos. Thus, Atropos will work only on the last read in
the input file.
In most cases, you should probably use - at most once for an input file and
at most once for an output file, in order not to get mixed output.
You cannot combine - and gzip compression since Atropos needs to know the
file name of the output or input file. if you want to have a gzip-compressed
output file, use -o with an explicit name.
One last “trick” is to use /dev/null as an output file name. This special
file discards everything you send into it. If you only want to see the
statistics output, for example, and do not care about the trimmed reads at all,
you could use something like this:
atropos -a AACCGGTT -o /dev/null -se input.fastq
Subsampling¶
If you only want to processes some of the reads in your input file, you have two
options. First, you can use the --max-reads <N> option to only process the
first N reads/pairs in the input. Second, you can use the --subsample <p>
option to sample a (pseudo)random fraction of the reads from the file, where the
fraction is defined by probability 0 < p <= 1. You can set a specific seed
using --subsample-seed to guarantee identical subsampling between runs.
Read processing¶
Atropos can do a lot more in addition to removing adapters. There are various command-line options that make it possible to modify and filter reads and to redirect them to various output files. Each read is processed in the following way:
- Read modification options are applied. This includes adapter removal, quality trimming, read name modifications etc.
- Filtering options are applied, such as removal of too short or untrimmed reads. Some of the filters also allow to redirect a read to a separate output file.
- If the read has passed all the filters, it is written to the output file.
Read modifications are applied in a specific order (below), and steps not requested on the command-line are skipped.
- Removing a fixed number of bases with
-c(C). - NextSeq polyG trimming with
--nextseq-trim(G). - Quality trimming with
-q/-Q(Q). - Adapter removal with
-a/-A,-b/-B, and-g/-G(A). - Bisulfite sequencing-specific trimming with
--bisulfite. - N trimming with
--trim-n. - Ensuring at least a fixed number of bases have been trimmed with
-i/-I. - Length tag modification with
--length-tag. - Read name suffix removal with
--strip-suffix. - Addition of prefix and suffix to read name with
-x/--prefixand-y/--suffix. - Double-encode the sequence (only colorspace).
- Replace negative quality values with zero (zero capping, only colorspace).
- Trim primer base (only colorspace).
The user can have some control over the order in which operations are applied. The
--op-order option takes a string of characters (in parentheses above) that controls the
order in which the first four operations are applied. By default, --op-order CGQA to maintain
compatibility with Cutadapt; however, this is likely to change to ‘GACQ’ in the near future.
Removing adapters¶
Atropos supports trimming of multiple types of adapters:
| Adapter type | Command-line option |
|---|---|
| 3’ adapter | -a ADAPTER |
| 5’ adapter | -g ADAPTER |
| Anchored 3’ adapter | -a ADAPTER$ |
| Anchored 5’ adapter | -g ^ADAPTER |
| 5’ or 3’ (both possible) | -b ADAPTER |
| Linked adapter | -a ADAPTER1...ADAPTER2 |
Here is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
By default, all adapters are searched error-tolerantly. Adapter sequences may also contain the “N” wildcard character.
In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, and to remove low-quality bases (quality trimming) from the 3’ and 5’ ends.
Alignment algorithms¶
Cutadapt was developed when single-end reads were common, and thus its alignment algorithm was optimized for that data. It uses a very high-performance Implementation of semi-global alignment to identify adapters within reads. However, most current data sets are paired-end, which enables much better adapter trimming. With most paired-end read data, adapter contamination should be symmetric, because the sequencer reads the same number of bases in either direction. So, for example, if you have 150 bp paired-end reads and you have a read pair with an insert size of 130, the sequencer will read the 130 bp from the forward direction and then read an additional 20 bp of the forward adapter, and will then read the same 130 bp in the reverse direction followed by 20 bp of the reverse adapter. This means that adapter contamination can be more accurately detected by first aligning the reads to each other and then examining the overhangs for adapter sequences. This procedure is called insert alignment, as opposed to adapter alignment. Atropos implements a version of the algorithm described in Strum et al. (DOI: 10.1186/s12859-016-1069-7) that first attempts insert alignment (leveraging the dynamic programming model that was implemented in Cutadapt). If the insert match is successful, then a less stringent adapter match is performed. Otherwise, the normal Cutadapt-style adapter matching is performed.
This new algorithm only works with paired-end data that contains a single 3’ adapter in
each direction. To enable this aligner, use the --aligner insert option.
atropos --aligner insert -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o trimmed.1.fq.gz -p trimmed.2.fq.gz
-pe1 reads.1.fq.gz -pe2 reads.2.fq.gz
There are three parameters that can be used to fine-tune insert matching:
--insert-match-error-rate: Similar to-e/--error-rate, but specifically
for matching inserts. We find generally that it is safe and leads to greater
accuracy when the insert-match error rate is set higher than the global error
rate. For example -e 0.1 --insert-match-error-rate 0.2 works well for high-quality
data.
* --insert-match-adapter-error-rate: Maximum allowed error rate for matching
adapters after successful insert match. This is typically used when you want less
stringent adapter matching when there is already evidence of an insert match. The
global error rate (-e) is still used when the algorithm is not able to make an
insert match and falls back to adapter matching.
* --insert-max-rmp: Random match probability (RMP) is the probability
that two different sequences of length N will match each other by chance. You can
specify an RMP threshold in addition to/instead of error rate and minimum overlap.
Error correction¶
Read pairs that overlap are derived from the same sequence, and are thus expected to be identical.
However, all sequencing technologies are associated with some level of error that may lead to
mismatches. The insert aligner is able to correct mismatches between overlapping reads using one
of three strategies (set using the --correct-mismatches option):
- conservative: When the qualities of the bases are different, set the base to be the one with the highest quality/lowest error probability. When the qualities are equal, do not change them.
- liberal: Same policy as ‘conservative’, except that when qualities are the same set the base to be the one from the read with the highest median quality.
- N: Set the base to ‘N’ in both pairs.
Note that in all cases where error correction is enabled, if exactly one base is an N, it is set to be the base from the other pair.
3’ adapters¶
A 3’ adapter is a piece of DNA ligated to the 3’ end of the DNA fragment you are interested in. The sequencer starts the sequencing process at the 5’ end of the fragment and sequences into the adapter if the read is long enough. The read that it outputs will then have a part of the adapter in the end. Or, if the adapter was short and the read length quite long, then the adapter will be somewhere within the read (followed by other bases).
For example, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:
MYSEQUEN
MYSEQUENCEADAP
MYSEQUENCEADAPTER
MYSEQUENCEADAPTERSOMETHINGELSE
Use atropos’ -a ADAPTER option to remove this type of adapter. This will
be the result:
MYSEQUEN
MYSEQUENCE
MYSEQUENCE
MYSEQUENCE
As can be seen, atropos correctly deals with partial adapter matches, and also with any trailing sequences after the adapter. Atropos deals with 3’ adapters by removing the adapter itself and any sequence that may follow. If the sequence starts with an adapter, like this:
ADAPTERSOMETHING
Then the sequence will be empty after trimming. By default, empty reads are kept and will appear in the output.
5’ adapters¶
Note
Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5’ adapter, described in the next section.
A 5’ adapter is a piece of DNA ligated to the 5’ end of the DNA fragment of interest. The adapter sequence is expected to appear at the start of the read, but may be partially degraded. The sequence may also appear somewhere within the read. In all cases, the adapter itself and the sequence preceding it is removed.
Again, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. The reads may look like this:
ADAPTERMYSEQUENCE
DAPTERMYSEQUENCE
TERMYSEQUENCE
SOMETHINGADAPTERMYSEQUENCE
All the above sequences are trimmed to MYSEQUENCE when you use -g ADAPTER.
As with 3’ adapters, the resulting read may have a length of zero when the
sequence ends with the adapter. For example, the read
SOMETHINGADAPTER
will be empty after trimming.
Anchored 5’ adapters¶
In many cases, the above behavior is not really what you want for trimming 5’ adapters. You may know, for example, that degradation does not occur and that the adapter is also not expected to be within the read. Thus, you always expect the read to look like the first example from above:
ADAPTERSOMETHING
If you want to trim only this type of adapter, use -g ^ADAPTER. The ^ is
supposed to indicate the the adapter is “anchored” at the beginning of the read.
In other words: The adapter is expected to be a prefix of the read. Note that
cases like these are also recognized:
ADAPTER
ADAPT
ADA
The read will simply be empty after trimming.
Be aware that Atropos still searches for adapters error-tolerantly and, in particular, allows insertions. So if your maximum error rate is sufficiently high, even this read will be trimmed:
BADAPTERSOMETHING
The B in the beginnig is seen as an insertion. If you also want to prevent
this from happening, use the option --no-indels to disallow insertions and
deletions entirely.
Anchored 3’ adapters¶
It is also possible to anchor 3’ adapters to the end of the read. This is
rarely necessary, but if you have merged, for example, overlapping paired-end
reads, then it is useful. Add the $ character to the end of an
adapter sequence specified via -a in order to anchor the adapter to the
end of the read, such as -a ADAPTER$. The adapter will only be found if it
is a suffix of the read, but errors are still allowed as for 5’ adapters.
You can disable insertions and deletions with --no-indels.
Anchored 3’ adapters work as if you had reversed the sequence and used an appropriate anchored 5’ adapter.
As an example, assume you have these reads:
MYSEQUENCEADAP
MYSEQUENCEADAPTER
MYSEQUENCEADAPTERSOMETHINGELSE
Using -a ADAPTER$ will result in:
MYSEQUENCEADAP
MYSEQUENCE
MYSEQUENCEADAPTERSOMETHINGELSE
Only the middle read is trimmed at all.
Linked adapters¶
This is a combination of a 5’ and a 3’ adapter. Use -a ADAPTER1...ADAPTER2
to search for a linked adapter. ADAPTER1 is interpreted as an anchored 5’
adapter, which is searched for first. Only if ADAPTER1 is found will then
ADAPTER2 be searched for, which is a regular 3’ adapter.
This feature is experimental and will probably break when used in combination
with some other options, such as --info-file, --mask-adapter.
5’ or 3’ adapters¶
The last type of adapter is a combination of the 5’ and 3’ adapter. You can use it when your adapter is ligated to the 5’ end for some reads and to the 3’ end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.
For this type of adapter, the sequence is specified with -b ADAPTER (or use
the longer spelling --anywhere ADAPTER). The adapter may appear in the
beginning (even degraded), within the read, or at the end of the read (even
partially). The decision which part of the read to remove is made as follows: If
there is at least one base before the found adapter, then the adapter is
considered to be a 3’ adapter and the adapter itself and everything
following it is removed. Otherwise, the adapter is considered to be a 5’
adapter and it is removed from the read, but the sequence after it remains.
Here are some examples.
| Read before trimming | Read after trimming | Detected adapter type |
|---|---|---|
MYSEQUENCEADAPTERSOMETHING |
MYSEQUENCE |
3’ adapter |
MYSEQUENCEADAPTER |
MYSEQUENCE |
3’ adapter |
MYSEQUENCEADAP |
MYSEQUENCE |
3’ adapter |
MADAPTER |
M |
3’ adapter |
ADAPTERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
PTERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
TERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
The -b option cannot be used with colorspace data.
Error tolerance¶
All searches for adapter sequences are error tolerant. Allowed errors are
mismatches, insertions and deletions. For example, if you search for the
adapter sequence ADAPTER and the error tolerance is set appropriately
(as explained below), then also ADABTER will be found (with 1 mismatch),
as well as ADAPTR (with 1 deletion), and also ADAPPTER (with 1
insertion).
The level of error tolerance is adjusted by specifying a maximum error rate,
which is 0.1 (=10%) by default. Use the -e option to set a different value.
To determine the number of allowed errors, the maximum error rate is multiplied
by the length of the match (and then rounded off).
What does that mean?
Assume you have a long adapter LONGADAPTER and it appears in full somewhere
within the read. The length of the match is 11 characters since the full adapter
has a length of 11, therefore 11·0.1=1.1 errors are allowed with the default
maximum error rate of 0.1. This is rounded off to 1 allowed error. So the
adapter will be found within this read:
SEQUENCELONGADUPTERSOMETHING
If the match is a bit shorter, however, the result is different:
SEQUENCELONGADUPT
Only 9 characters of the adapter match: LONGADAPT matches LONGADUPT
with one substitution. Therefore, only 9·0.1=0.9 errors are allowed. Since this
is rounded off to zero allowed errors, the adapter will not be found.
The number of errors allowed for a given adapter match length is also shown in the report that Atropos prints:
Sequence: 'LONGADAPTER'; Length: 11; Trimmed: 2 times.
No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1
This tells us what we now already know: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.
The reason for this behavior is to ensure that short matches are not favored unfairly. For example, assume the adapter has 40 bases and the maximum error rate is 0.1, which means that four errors are allowed for full-length matches. If four errors were allowed even for a short match such as one with 10 bases, this would mean that the error rate for such a case is 40%, which is clearly not what was desired.
Insertions and deletions can be disallowed by using the option
--no-indels.
Multiple adapter occurrences within a single read¶
If a single read contains multiple copies of the same adapter, the basic rule is that the leftmost match is used for both 5’ and 3’ adapters. For example, when searching for a 3’ adapter in
cccccADAPTERgggggADAPTERttttt
the read will be trimmed to
ccccc
When the adapter is a 5’ adapter instead, the read will be trimmed to
gggggADAPTERttttt
The above applies when both occurrences of the adapter are exact matches, and it also applies when both occurrences of the adapter are inexact matches (that is, it has at least one indel or mismatch). However, if one match is exact, but the other is inexact, then the exact match wins, even if it is not the leftmost one! The reason for this behavior is that Atropos searches for exact matches first and, to improve performance, skips the error-tolerant matching step if an exact match was found.
Reducing random matches¶
Since Atropos allows partial matches between the read and the adapter sequence,
short matches can occur by chance, leading to erroneously trimmed bases. For
example, roughly 25% of all reads end with a base that is identical to the
first base of the adapter. To reduce the number of falsely trimmed bases, Atropos
uses a threshold based on random-match probability (RMP). The default threshold
is 1x10^-6, but you can change this with the --adapter-max-rmp option.
Another way you can control random matches is by specifying a minimum overlap
between the adapter and the read. The minimum overlap length can be changed with
the parameter --overlap (or its short version -O). Shorter matches are
simply ignored, and the bases are not trimmed. Note that we generally find the
RMP-based control to be sufficient, and thus setting a minimum overlap is usually
not necessary.
Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see Section 2.3.3 in my thesis. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.
When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than zero, reducing Atropos’ sensitivity.
Wildcards¶
All IUPAC nucleotide codes
(wildcard characters) are supported. For example, use an N in the adapter
sequence to match any nucleotide in the read, or use -a YACGT for an adapter
that matches both CACGT and TACGT. The wildcard character N is
useful for trimming adapters with an embedded variable barcode:
atropos -a ACGTAANNNNTTAGC -o output.fastq -se input.fastq
Wildcard characters in the adapter are enabled by default. Use the option -N
to disable this.
Matching of wildcards in the reads is also possible, but disabled by default
in order to avoid matches in reads that consist of many (often low-quality)
N bases. Use --match-read-wildcards to enable wildcards also in reads.
If wildcards are disabled entirely (that is, you use -N and do not use
--match-read-wildcards), then Atropos compares characters by ASCII value.
Thus, both the read and adapter can be arbitrary strings (such as SEQUENCE
or ADAPTER as used here in the examples).
Wildcards do not work in colorspace.
Repeated bases in the adapter sequence¶
If you have many repeated bases in the adapter sequence, such as many N``s or
many ``A``s, you do not have to spell them out. For example, instead of writing
ten ``A in a row (AAAAAAAAAA), write A{10} instead. The number within
the curly braces specifies how often the character that preceeds it will be
repeated. This works also for IUPAC wildcard characters, as in N{5}.
It is recommended that you use quotation marks around your adapter sequence if you use this feature. For poly-A trimming, for example, you would write:
atropos -a "A{100}" -o output.fastq -se input.fastq
Specifying adapters by name¶
Rather than enter your adapter sequences each time or maintain separate adapter files for each of your datasets, you can maintain a single adapter file (in FASTA format) and specify adapters by name:
atropos -F myadapters.fa -a TruSeq1 -A TruSeq2 ...
If you are using standard adapter sequences, it is likely that they are already
included in the Atropos adapter definition file,
in which case you can omit the -F option and Atropos will automatically fetch
the file from the GitHub repository (assuming you have an internet connection).
Atropos will cache the adapters found in either the default or the user-specified
adapter file (in a .adapters file, unless you specify a different path using the
--adapter-cache-file option). You can disable the fetching and use of the
default adapter file with the --no-default-adapters option. You can disable
adapter caching using the --no-cache-adapters option.
Modifying reads¶
This section describes in which ways reads can be modified other than adapter removal.
Removing a fixed number of bases¶
By using the --cut option or its abbreviation -u, it is possible to
unconditionally remove bases from the beginning or end of each read. If
the given length is positive, the bases are removed from the beginning
of each read. If it is negative, the bases are removed from the end.
For example, to remove the first five bases of each read:
atropos -u 5 -o trimmed.fastq -se reads.fastq
To remove the last seven bases of each read:
atropos -u -7 -o trimmed.fastq -se reads.fastq
The -u/--cut option can be combined with the other options, but
the desired bases are removed before any adapter trimming.
The --cut-min option (-i) works identically to the --cut
option, except that bases are removed after all other modifications have
been applied, and only if the required number of bases have not already
been removed. For example, if the following sequence is in reads.fastq:
ACGTACGTACGTADAP
The following command will first trim the ADAP part of the adapter
off the end. Then, since only 4 bases were trimmed, the -i 5 option
will cause a 5th base to be removed.
atropos -A ADAPTER -i 5 -o trimmed.fastq -se reads.fastq
Quality trimming¶
The -q (or --quality-cutoff) parameter can be used to trim
low-quality ends from reads before adapter removal. For this to work
correctly, the quality values must be encoded as ascii(phred quality +
33). If they are encoded as ascii(phred quality + 64), you need to add
--quality-base=64 to the command line.
Quality trimming can be done without adapter trimming, so this will work:
atropos -q 10 -o output.fastq -se input.fastq
By default, only the 3’ end of each read is quality-trimmed. If you want to
trim the 5’ end as well, use the -q option with two comma-separated cutoffs:
atropos -q 15,10 -o output.fastq -se input.fastq
The 5’ end will then be trimmed with a cutoff of 15, and the 3’ will be trimmed
with a cutoff of 10. If you only want to trim the 5’ end, then use a cutoff of
0 for the 3’ end, as in -q 10,0.
Quality trimming algorithm¶
The trimming algorithm is the same as the one used by BWA, but applied to both ends of the read in turn (if requested). That is: Subtract the given cutoff from all qualities; compute partial sums from all indices to the end of the sequence; cut the sequence at the index at which the sum is minimal. If both ends are to be trimmed, repeat this for the other end.
The basic idea is to remove all bases starting from the end of the read whose quality is smaller than the given threshold. This is refined a bit by allowing some good-quality bases among the bad-quality ones. In the following example, we assume that the 3’ end is to be quality-trimmed.
Assume you use a threshold of 10 and have these quality values:
42, 40, 26, 27, 8, 7, 11, 4, 2, 3
Subtracting the threshold gives:
32, 30, 16, 17, -2, -3, 1, -6, -8, -7
Then sum up the numbers, starting from the end (partial sums). Stop early if the sum is greater than zero:
(70), (38), 8, -8, -25, -23, -20, -21, -15, -7
The numbers in parentheses are not computed (because 8 is greater than zero), but shown here for completeness. The position of the minimum (-25) is used as the trimming position. Therefore, the read is trimmed to the first four bases, which have quality values 42, 40, 26, 27.
Modifying read names¶
If you feel the need to modify the names of processed reads, some of the following options may be useful.
Use -y or --suffix to append a text to read names. The given string can
contain the placeholder {name}, which will be replaced with the name of the
adapter found in that read. For example, writing
atropos -a adapter1=ACGT -y ' we found {name}' -se input.fastq
changes a read named read1 to read1 we found adapter1 if the adapter
ACGT was found. The options -x/--prefix work the same, but the text
is added in front of the read name. For both options, spaces need to be
specified explicitly, as in the above example. If no adapter was found in a
read, the text no_adapter is inserted for {name}.
In order to remove a suffix of each read name, use --strip-suffix.
Some old 454 read files contain the length of the read in the name:
>read1 length=17
ACGTACGTACAAAAAAA
If you want to update this to the correct length after trimming, use the option
--length-tag. In this example, this would be --length-tag 'length='.
After trimming, the read would perhaps look like this:
>read1 length=10
ACGTACGTAC
NextSeq-specific trimming¶
Some data from the new Illumina NextSeq platform generates base calls that have
high quality scores but are incorrect due to the use of only two fluorescent tags
(rather than the 4 used in the MiSeq and HiSeq sequencers). These base calls
appear as a polyG string at the end of the read. The --nextseq-trim option will
remove these bases.
Filtering reads¶
By default, all processed reads, no matter whether they were trimmed are not,
are written to the output file specified by the -o option (or to standard
output if -o was not provided). For paired-end reads, the second read in a
pair is always written to the file specified by the -p option.
The options described here make it possible to filter reads by either discarding them entirely or by redirecting them to other files. When redirecting reads, the basic rule is that each read is written to at most one file. You cannot write reads to more than one output file.
In the following, the term “processed read” refers to a read to which all modifications have been applied (adapter removal, quality trimming etc.). A processed read can be identical to the input read if no modifications were done.
--minimum-length Nor-m N- Throw away processed reads shorter than N bases.
--too-short-output FILE- Instead of throwing away the reads that are too short according to
-m, write them to FILE (in FASTA/FASTQ format). --maximum-length Nor-M N- Throw away processed reads longer than N bases.
--too-long-output FILE- Instead of throwing away the reads that are too long (according to
-M), write them to FILE (in FASTA/FASTQ format). --untrimmed-output FILE- Write all reads without adapters to FILE (in FASTA/FASTQ format) instead of writing them to the regular output file.
--discard-trimmed- Throw away reads in which an adapter was found.
--discard-untrimmed- Throw away reads in which no adapter was found. This has the same effect as
specifying
--untrimmed-output /dev/null.
The options --too-short-output and --too-long-output are applied first.
This means, for example, that a read that is too long will never end up in the
--untrimmed-output file when --too-long-output was given, no matter
whether it was trimmed or not.
The options --untrimmed-output, --discard-trimmed and -discard-untrimmed
are mutually exclusive.
Trimming paired-end reads¶
Atropos supports trimming of paired-end reads, trimming both reads in a pair at the same time.
Assume the input is in reads.1.fastq and reads.2.fastq and that
ADAPTER_FWD should be trimmed from the forward reads (first file)
and ADAPTER_REV from the reverse reads (second file).
The basic command-line is:
atropos -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq -pe1 reads.1.fastq -pe2 reads.2.fastq
-p is the short form of --paired-output. The option -A is used here
to specify an adapter sequence that Atropos should remove from the second read
in each pair. There are also the options -G, -B. All of them work just
like their lowercase counterparts, except that the adapter is searched for in
the second read in each paired-end read. There is also option -U, which you
can use to remove a fixed number of bases from the second read in a pair.
While it is possible to run Atropos on the two files separately, processing both files at the same time is highly recommended since the program can check for problems in your input files only when they are processed together.
When you use -p/--paired-output, Atropos checks whether the files are
properly paired. An error is raised if one of the files contains more reads than
the other or if the read names in the two files do not match. Only the part of
the read name before the first space is considered. If the read name ends with
/1 or /2, then that is also ignored. For example, two FASTQ headers that
would be considered to denote properly paired reads are:
@my_read/1 a comment
and:
@my_read/2 another comment
As soon as you start to use one of the filtering options that discard reads, it is mandatory you process both files at the same time to make sure that the output files are kept synchronized: If a read is removed from one of the files, Atropos will ensure it is also removed from the other file.
The following command-line options are applied to both reads:
-q(along with--quality-base)--timesapplies to all the adapters given--no-trim--trim-n--mask--length-tag--prefix,--suffix--strip-f3--colorspace,--bwa,-z,--no-zero-cap,--double-encode,--trim-primer
The following limitations still exist:
- The
--info-file,--rest-fileand--wildcard-fileoptions write out information only from the first read. - Demultiplexing is not yet supported with paired-end data.
Filtering paired-end reads¶
The filtering options listed above can also be used when trimming paired-end data. Since there are two reads, however, the filtering criteria are checked for both reads. The question is what to do when a criterion applies to only one read and not the other.
By default, the filtering options discard or redirect the read pair if any
of the two reads fulfill the criteria. That is, --max-n discards the pair
if one of the two reads has too many N bases; --discard-untrimmed
discards the pair if one of the reads does not contain an adapter;
--minimum-length discards the pair if one of the reads is too short;
and --maximum-length discards the pair if one of the reads is too long.
Note that the --discard-trimmed filter would also apply because it is also
the case that at least one of the reads is trimmed!
To require that filtering criteria must apply to both reads in order for a
read pair to be considered “filtered”, use the option --pair-filter=both.
To further complicate matters, Atropos switches to a backwards compatibility
mode (“legacy mode”) when none of the uppercase modification options
(-A/-B/-G/-U) are given. In that mode, filtering criteria are
checked only for the first read. Atropos will also tell you at the top of
the report whether legacy mode is active. Check that line if you get strange
results!
These are the paired-end specific filtering and output options:
--paired-output FILEor-p FILE- Write the second read of each processed pair to FILE (in FASTA/FASTQ format).
--untrimmed-paired-output FILE- Used together with
--untrimmed-output. The second read in a pair is written to this file when the processed pair was not trimmed. --pair-filter=(any|both)- Which of the reads in a paired-end read have to match the filtering criterion in order for it to be filtered.
Note that the option names can be abbreviated as long as it is clear which
option is meant (unique prefix). For example, instead of --untrimmed-output
and --untrimmed-paired-output, you can write --untrimmed-o and
--untrimmed-p.
Interleaved paired-end reads¶
Paired-end reads can be read from a single FASTQ file in which the entries for
the first and second read from each pair alternate. The first read in each pair
comes before the second. Enable this file format by specifying an input file
using the -l (--interleaved-input) option. For example:
atropos -q 20 -a ACGT -A TGCA -o trimmed.fastq -l reads.fastq
The output can also be interleaved, using the -L (--interleaved-output)
option. Atropos will detect if the input file is not properly interleaved by
checking whether read names match and whether the file contains an even number of
entries.
When interleaved input is used, legacy mode is disabled (that is,
read-modification options such as -q always apply to both reads).
Legacy paired-end read trimming¶
Note
This section describes the way paired-end trimming was done
in Cutadapt before 1.8, where the -A, -G, -B options were not
available. It is less safe and more complicated, but you can still use it.
If you do not use any of the filtering options that discard reads, such
as --discard, --minimum-length or --maximum-length, you can run
Atropos on each file separately:
atropos -a ADAPTER_FWD -o trimmed.1.fastq -se reads1.fastq
atropos -a ADAPTER_REV -o trimmed.2.fastq -se reads2.fastq
You can use the options that are listed under ‘Additional modifications’ in atropos’ help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:
atropos -q 10 -a ADAPTER_FWD -o trimmed.1.fastq -se reads1.fastq
atropos -q 15 -a ADAPTER_REV -o trimmed.2.fastq -se reads2.fastq
If you use any of the filtering options, you must use Atropos in the following
way (with the -p option) to make sure that read pairs remain sychronized.
First trim the forward read, writing output to temporary files (we also add some quality trimming):
atropos -q 10 -a ADAPTER_FWD --minimum-length 20 -o tmp.1.fastq -p tmp.2.fastq -pe1 reads.1.fastq -pe2 reads.2.fastq
Then trim the reverse read, using the temporary files as input:
atropos -q 15 -a ADAPTER_REV --minimum-length 20 -o trimmed.2.fastq -p trimmed.1.fastq -pe1 tmp.2.fastq -pe2 tmp.1.fastq
Finally, remove the temporary files:
rm tmp.1.fastq tmp.2.fastq
Please see the previous section for a much simpler way of trimming paired-end reads!
In legacy paired-end mode, the read-modifying options such as -q only
apply to the first file in each call to Atropos (first reads.1.fastq, then
tmp.2.fastq in this example). Reads in the second file are not affected by those
options, but by the filtering options: If a read in the first file is
discarded, then the matching read in the second file is also filtered
and not written to the output given by --paired-output in order to
keep both output files synchronized.
Multiple adapters¶
It is possible to specify more than one adapter sequence by using the options
-a, -b and -g more than once. Any combination is allowed, such as
five -a adapters and two -g adapters. Each read will be searched for
all given adapters, but only the best matching adapter is removed. (But it
is possible to trim more than one adapter from each
read). This is how a command may look like to trim one of two
possible 3’ adapters:
atropos -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq -se input.fastq
The adapter sequences can also be read from a FASTA file. Instead of giving an
explicit adapter sequence, you need to write file: followed by the name of
the FASTA file:
atropos -a file:adapters.fasta -o output.fastq -se input.fastq
All of the sequences in the file adapters.fasta will be used as 3’
adapters. The other adapter options -b and -g also support this. Again,
only the best matching adapter is trimmed from each read.
When Atropos has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:
- All given adapter sequences are matched to the read.
- Adapter matches where the overlap length (see the
-Oparameter) is too small or where the error rate is too high (-e) are removed from further consideration. - Among the remaining matches, the one with the greatest number of matching bases is chosen.
- If there is a tie, the first adapter wins. The order of adapters is the order in which they are given on the command line or in which they are found in the FASTA file.
If your adapter sequences are all similar and differ only by a variable barcode sequence, you should use a single adapter sequence instead that contains wildcard characters.
NOTE: The insert-match algorithm currently only supports using a single pair of 3’ adapters.
Named adapters¶
Atropos reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:
=== Adapter 1 ===
Sequence: AACCGGTT; Length 8; Trimmed: 5 times.
If you want this to look a bit nicer, you can give each adapter a name in this way:
atropos -a My_Adapter=AACCGGTT -o output.fastq -se input.fastq
The actual adapter sequence in this example is AACCGGTT and the name
assigned to it is My_Adapter. The report will then contain this name in
addition to the other information:
=== Adapter 'My_Adapter' ===
Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.
When adapters are read from a FASTA file, the sequence header is used as the adapter name.
Adapter names are also used in column 8 of info files.
Demultiplexing¶
Atropos supports demultiplexing, which means that reads are written to different
output files depending on which adapter was found in them. To use this, include
the string {name} in the name of the output file and give each adapter a name.
The path is then interpreted as a template and each trimmed read is written
to the path in which {name} is replaced with the name of the adapter that
was found in the read. Reads in which no adapter was found will be written to a
file in which {name} is replaced with unknown.
Example:
atropos -a one=TATA -a two=GCGC -o trimmed-{name}.fastq.gz -se input.fastq.gz
This command will create the three files demulti-one.fastq.gz,
demulti-two.fastq.gz and demulti-unknown.fastq.gz. You can also
provide adapter sequences in a FASTA file.
In order to not trim the input files at all, but to only do multiplexing, use
option --no-trim. And if you want to output the reads in which no
adapters were found to a different file, use the --untrimmed-output
parameter with a file name. Here is an example that uses both parameters and
reads the adapters from a FASTA file (note that --untrimmed-output can be
abbreviated):
atropos -a file:barcodes.fasta --no-trim --untrimmed-o untrimmed.fastq.gz -o trimmed-{name}.fastq.gz -se input.fastq.gz
Trimming more than one adapter from each read¶
By default, at most one adapter sequence is removed from each read, even if
multiple adapter sequences were provided. This can be changed by using the
--times option (or its abbreviated form -n). Atropos will then search
for all the given adapter sequences repeatedly, either until no adapter match
was found or until the specified number of rounds was reached.
As an example, assume you have a protocol in which a 5’ adapter gets ligated to your DNA fragment, but it’s possible that the adapter is ligated more than once. So your sequence could look like this:
ADAPTERADAPTERADAPTERMYSEQUENCE
To be on the safe side, you assume that there are at most 5 copies of the adapter sequence. This command can be used to trim the reads correctly:
atropos -g ^ADAPTER -n 5 -o output.fastq -se input.fastq
This feature can also be used to search for 5’/3’ linked adapters. For example, when the 5’ adapter is FIRST and the 3’ adapter is SECOND, then the read could look like this:
FIRSTMYSEQUENCESECOND
That is, the sequence of interest is framed by the 5’ and the 3’ adapter. The following command can be used to trim such a read:
atropos -g ^FIRST -a SECOND -n 2 ...
Support for linked adapters is currently incomplete. For example, it is not possible to specify that SECOND should only be trimmed when FIRST also occurs. See also this feature request, and comment on it if you would like to see this implemented.
Illumina TruSeq¶
If you have reads containing Illumina TruSeq adapters, follow these steps.
Single-end reads as well as the first reads of paired-end data need to be
trimmed with A + the “TruSeq Indexed Adapter”. Use only the prefix of the
adapter sequence that is common to all Indexed Adapter sequences:
atropos -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o trimmed.fastq.gz -se reads.fastq.gz
If you have paired-end data, trim also read 2 with the reverse complement of the “TruSeq Universal Adapter”. The full command-line looks as follows:
atropos \
-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \
-o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
-pe1 reads.1.fastq.gz -pe2 reads.2.fastq.gz
See also the section about paired-end adapter trimming above.
If you want to simplify this a bit, you can also use the common prefix
AGATCGGAAGAGC as the adapter sequence in both cases:
atropos \
-a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
-pe1 reads.1.fastq.gz -pe2 reads.2.fastq.gz
The adapter sequences can be found in the document Illumina TruSeq Adapters De-Mystified.
Warning about incomplete adapter sequences¶
Sometimes Atropos’ report ends with these lines:
WARNING:
One or more of your adapter sequences may be incomplete.
Please see the detailed output above.
Further up, you’ll see a message like this:
Bases preceding removed adapters:
A: 95.5%
C: 1.0%
G: 1.6%
T: 1.6%
none/other: 0.3%
WARNING:
The adapter is preceded by "A" extremely often.
The provided adapter sequence may be incomplete.
To fix the problem, add "A" to the beginning of the adapter sequence.
This means that in 95.5% of the cases in which an adapter was removed from a
read, the base coming before that was an A. If your DNA fragments are
not random, such as in amplicon sequencing, then this is to be expected and
the warning can be ignored. If the DNA fragments are supposed to be random,
then the message may be genuine: The adapter sequence may be incomplete and
should include an additional A in the beginning.
This warning exists because some documents list the Illumina TruSeq adapters
as starting with GATCGGA.... While that is technically correct, the
library preparation actually results in an additional A before that
sequence, which also needs to be removed. See the previous
section for the correct sequence.
Dealing with N bases¶
Atropos supports the following options to deal with N bases in your reads:
--max-n COUNT- Discard reads containing more than COUNT
Nbases. A fractional COUNT between 0 and 1 can also be given and will be treated as the proportion of maximally allowedNbases in the read. --trim-nRemove flanking
Nbases from each read. That is, a read such as this:NNACGTACGTNNNNIs trimmed to just
ACGTACGT. This option is applied after adapter trimming. If you want to get rid ofNbases before adapter removal, use quality trimming:Nbases typically also have a low quality value associated with them.
Read merging and overwriting¶
Overlapping reads can lead to double-counting of sites in down-stream quantitative analyses that treat each read in a pair independently. Atropos can merge overlapping reads, which means that the pair will be collapsed into a single read.
Read merging is enable by the --merge-overlapping option. During merging,
any mismatches are corrected according to the mismatch correction policy (determined
by --correct-mismatches, see Error correction). The following
parameters enable fine-tuning of the merge process:
--merge-min-overlap: The minimum overlap between reads required for merging. If this number is (0,1.0], it specifies the minimum length as the fraction of the length of the shorter read in the pair; otherwise it specifies the minimum number of overlapping base pairs (with an absolute minimum of 2 bp).--merge-error-rate: The maximum error rate when aligning reads for merging.
IMPORTANT: By default, merged reads are discarded. Merged reads cannot be written
to FASTQ output because it breaks the required read pairing between files. You can
write merged reads to a separate, “single-end” FASTQ file using the --merged-output
option.
Overwriting low-quality reads¶
In some atypical situations, you may end up with data in which one read in a pair is
of substantially worse quality than the other read. In such cases, you may want to
ignore the poor-quality read entirely and, rather than throw out the read pair,
substitute the better quality read for the worse-quality read. This is done using
--overwrite-low-quality LOWQ,HIGHQ,WINDOW, meaining that when one read has
mean quality < LOWQ and the other read has mean quality >= HIGHQ over the first
WINDOW bases, the better-quality read overwrites the worse-quality read.
Note that if read merging is enabled, such reads will be treated as merged and
either discarded or written to --merged-output.
Whether read-merging occurs also depends on the order of trimming operations.
Order of modifications¶
Read trimming tools that support both adapter and quality trimming differ in the
order in which the apply these operations. Cutadapt performs adapter trimming
first, followed by quality trimming. Atropos enables you to specify the order in
which you’d like operations applied using --op-order. The order of the
following 5 operations can be customized:
- A = adapter trimming
- C = cutting (unconditional)
- G = NextSeq trimming
- Q = quality trimming
- W = overwrite poor quality reads
The default order of operations is “CGQAW” to maintain backward-compatibility with Cutadapt. However, we find that using the order “GAWCQ” generally leads to better results; this is likely to become the default in Atropos 2.0+.
Bisulfite sequencing¶
Proper trimming of Methyl-Seq reads is critical to accurate downstream analysis. When trimming reads that come from bisulfite-converted DNA, it is necessary to trim certain bases to avoid bias in estimating methylation. The trimming parameters are different for each type of library preparation. Atropos provides an option to enable automated trimming of Methyl-Seq reads according to the best practices recommended by library construction kit manufacturers or in the literature:
- Reduced-representation bisulfite sequencing (RRBS): RRBS relies on a
restriction enzyme (MspI) for genome fragmentation. MspI leaves a 2 bp overhang that is filled in during end-repair prior to adapter ligation. The filled-in cytosine will not be reflective of the true methylation state, and thus needs to be trimmed away. For reads in which the adapter sequence is detected, Atropos ensures that at least two additional bases are trimmed after the adapter sequence is removed. Alternatively, you can use the method that was previously recommended for use with Cutadapt:
atropos -a NNADAPTER -o output.fastq -se input.fastq
- Non-directional bisulfite sequencing: Early bisulfite sequencing protocols,
including paired-end RRBS and whole-genome bisulfite libraries constructed prior to current-generation protocols (see below), can generate strand-complementary reads whose 5’ ends begin with CAA or CGA tri-nucleotides, which are also an artifact of MspI digestion. For reads in which the first three 5’ bases are CAA or CGA, Atropos ensures that at least 2 bases are trimmed from the 5’ end. For non-directional RRBS, the 3’ 2 bp of adapter-trimmed reads are removed only if the 5’ end does not start with CAA or CGA. * EpiGnome Methyl-Seq and TruSeq DNA Methylation kits: These kits introduce adapters by tagmentation of bisulfite-converted reads. Trimming of these reads beyond adapter trimming is not required. * Accel-NGS Methyl-Seq: Accel-NGS (Swift Biosciences) is a recently introduced library construction kit for directional RRBS, WGBS, and other Methyl-Seq protocols. An artifact of adding the adapter sequences is that up to 10 bp of low-complexity sequence are introduced into the 3’ end of the template DNA, and thus must be trimmed away. Atropos removes 10 bp from the end of read 1 and the beginning of read 2, as recommended by the manufacturer.
Additionally, in bisulfite mode, Atropos uses an expected nucleotide frequency of 0.33 rather than 0.25 for computing random-match probabilities, since ‘C’ nucleotides are very infrequent. While it would be more technically correct to use nucleotide-specific probabilities for each species and assay type, in practice this level of complexity would have an impact on performance and would be unlikely to change the results substantially, as observed by Sturm et al (2016).
Micro-RNA sequencing¶
Several default options are recommended for miRNA-seq, including allowing a higher error rate for matching the adapter (0.12), requiring a minimum sequence length to retain reads (16), and using a minimum quality threshold for end trimming (20). Using the –mirna option sets these defaults, and, in addition, sets the adapter sequence to the Illumina small RNA adapter by default.
Multi-threading¶
The main advance in Atropos relative to Cutadapt is the ability to utilize multiple
processors to speed up read trimming. By default, Atropos uses a single thread to
read input, process reads, and write output. To use multiple cores, specify the
-T (or --threads) option with the number of threads to use for trimming:
atropos -T 4 -a ADAPTER -o output.fastq -se input.fastq
It is important to note that, whatever number of threads you give Atropos, it will
use one of those for reading input and, if you use the --compression writer option
(or if writer compression is used automatically), another for writing output. For
example, the above command would use 4 cores, 1 reader thread, 1 writer thread, and
2 trimming threads. It is recommended that you have at least 2 available cores when
using multi-threading.
Also note that the multi-threading model in Atropos is programmed to not make any
assumptions about or impose any limiations on the runtimes of individual tasks.
Instead, there is a “timeout” period, after which the log messages reporting on
the status of the processing escalate from “debug” to “error.” You can change the
timeout length using the --process-timeout option. But don’t be alarmed if you
see messages such as the following:
ERROR: Waiting on worker summaries for 65.0 seconds ERROR: Workers are still alive and haven’t returned summaries: 1,4
This would be interpreted as “All of the data has been loaded, but worker threads 1 and 4 are still working on processing some of it.” These messages are only to keep you abreast of the status – a few minutes delay is normal, but if it starts to be tens of minutes or hours, something probably went wrong and you should kill the program (using Ctrl-C).
Parallel writing¶
In many cases, it is not actually necessary to write all results to the
same file. For example, if the next processing step after trimming is alignment, and your aligner
supports reading from multiple FASTQ files (or you are on a linux-based system and can use
process substitution) to concatenate multiple
files to a single input stream) then it can be much faster to have worker threads write results
directly to separate files. This mode is enabled by specifying the --no-writer-process
option, and is compatible with both local and cluster modes.
Technical details¶
When the --threads option is set, the main process loads batches of reads from the
input file(s) and posts them to a Queue. One or more worker processes take batches from the
Queue and process them in much the same manner as cutadapt.
If compressed output is requested, the –compression option determines if compression is performed by the worker processes or by the writer process, and the default is based on how many threads you specify and whether you are using a system with a gzip program (which includes linux and OSX) – using system-level compression is about 2x faster than compressing files through the python interface. However, we find that with 8 or more threads, having the workers perform compression leads to an overall performance gain. Thus, the default is to use worker compression unless you have both fewer than 8 threads and system-level gzip. If worker compression is used, the worker processes compress the data before placing it on the result queue, and the writer process then takes batches of results from the result queue and writes them to disk. On the other hand, if writer compression is used, the workers place uncompressed results in the result queue, and the writer compresses them (if necessary) before writing them to disk.
One thread is reserved for the reader process, but once all reads are loaded an additional worker process is started since the reader process becomes idle. With writer compression, one thread is also reserved for the writer process, so you must have more than two available threads.
Other options¶
--preserve-order- Preserve order of reads in input files (ignored if –no-writer-process is set). By default, there is no guarantee as to how reads will be ordered in the output files (although read pairs are always guaranteed to be at identical positions in their respective files).
--read-queue-sizeand--result-queue-size- Communication between the reader thread and the trimmer threads, and between the trimmer threads and the writer thread, is all done using queues. Queue sizes are limited to prevent storing too much data in memory at once. The sizes of the queues can be controlled with these two parameters. Note that queue sizes are in numbers of batches, not numbers of reads.
--batch-size- The maximum number of reads in each batch. In our experience, this parameter tends not to have much effect on performance.
--process-timeout- When one party tries to do a read operation on an empty queue, or a write operation on a full queue, it will wait until either something is added to/removed from the queue, or until it is told to stop (because there was an error, or because the program finished running). Each time the operation polls the queue and is told to wait, it writes a DEBUG message. However, if the wait time exceeds the value set for this parameter, then those messages are escalated to ERROR level, which suggests that the user might want to investigate.
--compression- If ‘worker’, perform data compression in the worker (trimmer) processes; if ‘writer’, perform compression in the writer process. Otherwise, Atropos makes a choice based on whether system-level gzip is available.
Optimization¶
If you are going to be processing lots of data, we recommend taking some time to optimize Atropos
for your particular environment. You can do this by using the --max-reads parameter to limit
the number of input reads (we recommend 1-10 M reads to get a good idea of average processing time
per read) and then experiment with multiple parameter combinations. Turning on DEBUG log messages
(–log-level DEBUG) can also be helpful for this task. Note that increasing the number of available
threads has diminishing returns, and should certainly not exceed the number of cores available on your
system. We generally find 8 threads to offer the best trade-off between speed and resource usage, though
this may differ for your own environment.
Atropos’s output¶
How to read the report¶
After every run, Atropos prints out per-adapter statistics. The output starts with something like this:
Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.
The meaning of this should be obvious.
The next piece of information is this:
No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20 bp: 2
The adapter has, as was shown above, has a length of 20 characters. We are using the default error rate of 0.1. What this implies is shown above: Matches up to a length of 9 bp are allowed to have no errors. Matches of lengths 10-19 bp are allowd to have 1 error and matches of length 20 can have 2 errors. See also the section about error-tolerant matching.
Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:
Overview of removed sequences
length count expect max.err error counts
3 140 156.2 0 140
4 57 39.1 0 57
5 50 9.8 0 50
6 35 2.4 0 35
...
100 397 0.0 3 358 36 3
The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-9 bp).
The last column shows the number of reads that had 0, 1, 2 … errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.
The “expect” column gives only a rough estimate of the number of sequences that is expected to match randomly (it assumes a GC content of 50%, for example), but it can help to estimate whether the matches that were found are true adapter matches or if they are due to chance. At lengths 6, for example, only 2.4 reads are expected, but 35 do match, which hints that most of these matches are due to actual adapters.
Note that the “length” column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.
The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:
...
length count expect max.err error counts
10 53 0.0 1 51 2
11 45 0.0 1 42 3
12 51 0.0 1 48 3
13 39 0.0 1 0 39
14 40 0.0 1 0 40
15 36 0.0 1 0 36
...
We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.
Saving to file¶
You can re-direct the summary report to a file using the --report-file option.
Serialized formats¶
Atropos collects statistics on all aspects of the trimming process. These statistics are used in generating the summary report. However, you can also choose to output the statistics in raw form into a serialized file format. Currently, three formats are supported:
Note that JSON and YAML are language-independent, text-based formats, while Pickle is a python-specific binary format.
You can save one of these formats in one of two ways:
Change the file extension of the
--report-file:atropos --report-file summary.yaml ...
Set the
--report-formatsoption. When doing this, you can specify more than
one type of output file, and you use the --report-file option to specify the
file name prefix:
atropos --report-file summary --report-formats txt yaml json
We provide an Atropos module in the MultiQC package that reads the JSON summary output directly.
TODO: Describe the format of the JSON/YAML/Pickle dictionary.
TODO: Document using custom report formats via Jinja2 templates.
Format of the info file¶
When the --info-file command-line parameter is given, detailed
information about the found adapters is written to the given file. The
output is a tab-separated text file. Each line corresponds to one read
of the input file (unless –times is used, see below). The fields are:
- Read name
- Number of errors
- 0-based start coordinate of the adapter match
- 0-based end coordinate of the adapter match
- Sequence of the read to the left of the adapter match (can be empty)
- Sequence of the read that was matched to the adapter
- Sequence of the read to the right of the adapter match (can be empty)
- Name of the found adapter.
- Quality values corresponding to sequence left of the adapter match (can be empty)
- Quality values corresponding to sequence matched to the adapter (can be empty)
- Quality values corresponding to sequence to the right of the adapter match (can be empty)
The concatenation of the fields 5-7 yields the full read sequence. Column 8 identifies the found adapter. The section about named adapters <named-adapters> describes how to give a name to an adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
If no adapter was found, the format is as follows:
- Read name
- The value -1
- The read sequence
- Quality values
When parsing the file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line.
If the --times option is used and greater than 1, each read can appear
more than once in the info file. There will be one line for each found adapter,
all with identical read names. Only for the first of those lines will the
concatenation of columns 5-7 be identical to the original read sequence (and
accordingly for columns 9-11). For subsequent lines, the shown sequence are the
ones that were used in subsequent rounds of adapter trimming, that is, they get
successively shorter.
Quality control statistics¶
FastQC is a popular program for generating quality control (QC) metrics on raw read data. It is common practice to examine QC metrics both before and after trimming to identify any systematic data quality issues, to observe the improvements in data quality due to trimming, and to ensure that trimming does not introduce any unintended side-effects. Since both read trimming and QC involve iterating over all reads in the dataset, we reasoned that implementing both operations in the same tool would reduce the overall processing time, and also eliminate the need to install two separate tools.
You can enable QC using the --stats option of the trim subcommand. This
option takes one of three values controlling at what point(s) QC metrics are
collected: pre, post, and both. The --stats option can take additional arguments
to customize which metrics are collected. Currently, only the tiles parameter
is supported, which enables collecting tile-level metrics (Illumina only):
atropos --stats pre:tiles
To collect tile-level metrics, Atropos must parse the read name to obtain the tile ID. By default it uses a regular expression that matches standard Illumina read names:
^(?:[^\:]+\:){4}([^\:]+)
If you need to modify this regular expression, you can pass it as an argument to the tiles argument:
atropos --stats "pre:tiles=<myregexp>"
Additionally, there is a qc subcommand that only collects QC metrics (i.e. it
does not perform trimming).
QC metrics are added to the summary reports. Additionally, the Atropos MultiQC module can display a summary of the QC metrics.
Adapter detection¶
Often, details of sequencing library construction are not fully communicated
from the individual or facility that generated the library to the individual(s)
performing data analysis. Manual determination of sequencing adapters and other
potential library contaminants can be a tedious and error-prone task. Atropos
provides the detect subcommand to guess the most likely adapter sequence
from a sample of your data:
atropos detect -pe1 read1.fq -pe2 read2.fq
There are three algorithms you can use for detection. Atropos choses one by
default based on the other command line options, but you can specify an algorithm
using the -d/--detector option. The available detectors are:
- heuristic: Use a heuristic algorithm to detect adapter sequences. This is the
slowest and most memory-intensive algorithm, but also the most accurate. * khmer: Use the khmer library to identify frequent contaminants. This requires the optional khmer dependency to be installed. This algorithm is able to detect more rare contaminants than the heuristic algorithm, and is also more memory-efficient, but it also has higher false-positive and false-negative error rates. It is recommended to only use this algorithm if the heuristic algorithm fails. * known: Only match reads against known adapter sequences. The previous two algorithms can also match detected contaminant sequences against known adapters.
Because adapter sequences have been designed not to match any known sequence in
nature, a sequence (or pair of sequences) that occurs at high frequency and
matches a known adapter sequence is likely to be the true sequence(s) used as
adapters in the dataset. Thus, our algorithm optionally matches the
high-abundance k-mers to a list of known adapters/contaminants. By default,
Atropos uses a curated list of commonly used adapter sequences. You can specify
your own file (in FASTA format) using the --known-adapters-file option (see
“Specifying adapters by name for details). When a
contaminant list is not provided, or when the adapter does not match a known
sequence, we advise you to take caution when using the results of this
detection process, as a highly abundant sequence might simply be derived from a
frequently repeated element in the genome.
Error rate estimation¶
One of the most important parameters for adapter trimming is the error rate
(-e). For high-quality Illumina data, the default settings are sufficient.
However, it’s difficult to know the data quality a priori. Atropos provides the
error subcommand to estimate the error rate for setting the -e option:
atropos error -pe1 read1.fq -pe2 read2.fq
There are two error rate estimation algorithms provided. The default algorithm
simply averages the base quality scores in a sample of reads. This is likely to
be an overestimation of the true error rate, but computing it is very fast. A
more accurate but much slower algorithm is Shadow Regression (Wang et al.,
“Estimation of sequencing error rates in short reads”, BMC Bioinformatics 2012
13:185, DOI: 10.1186/1471-2105-13-185). Using the shadow regression algorithm
requires for R to be installed, as well as the ShadowRegression R package.
Once you’ve estimated the error rate, we recommend setting the -e option to
~10X the error rate. For example, if the estimated error is 0.9% (0.009), a good
value for -e is 0.1.