Recipes¶
For some trimming applications, the pre-defined adapter types behave differently from what you would like to have. In this section, we show some ways in which atropos can be made to behave in the desired way.
Note
This section is still being written.
Forcing matches to be at the end of the read¶
Use -a TACGGCATXXX. The X is always counted as a mismatch and will force
the adapter match to be at the end. This is not the same as an anchored 3’
adapter since partial matches are still allowed.
Removing more than one adapter¶
If you want to remove more than one adapter, let’s say a 5’ adapter and a 3’ adapter, you have two options.
First, you can specify both adapters and also --times=2 (or the short
version -n 2). For example:
atropos -g ^TTAAGGCC -a TACGGACT -n 2 -o output.fastq input.fastq
This instructs atropos to run two rounds of adapter finding and removal. That means that, after the first round and only when an adapter was actually found, another round is performed. In both rounds, all given adapters (two in this case) are searched and removed. The problem is that it could happen that one adapter is found twice (so the 3’ adapter, for example, could be removed twice).
The second option is to not use the -n option, but to run atropos twice,
first removing one adapter and then the other. It is easiest if you use a pipe
as in this example:
atropos -g ^TTAAGGCC input.fastq | atropos -a TACGGACT - > output.fastq
Trimming poly-A tails¶
If you want to trim a poly-A tail from the 3’ end of your reads, use the 3’
adapter type (-a) with an adapter sequence of many repeated A
nucleotides. Starting with version 1.8 of atropos, you can use the
following notation to specify a sequence that consists of 100 A:
atropos -a "A{100}" -o output.fastq input.fastq
This also works when there are sequencing errors in the poly-A tail. So this read
TACGTACGTACGTACGAAATAAAAAAAAAAA
will be trimmed to:
TACGTACGTACGTACG
If for some reason you would like to use a shorter sequence of A, you can
do so: The matching algorithm always picks the leftmost match that it can find,
so atropos will do the right thing even when the tail has more A than you
used in the adapter sequence. However, sequencing errors may result in shorter
matches than desired. For example, using -a "A{10}", the read above (where
the AAAT is followed by eleven A) would be trimmed to:
TACGTACGTACGTACGAAAT
Depending on your application, perhaps a variant of -a A{10}N{90} is an
alternative, forcing the match to be located as much to the left as possible,
while still allowing for non-A bases towards the end of the read.
Other things (unfinished)¶
- How to detect adapters
- Use atropos for quality-trimming only
- Use it for minimum/maximum length filtering
- Use it for conversion to FASTQ